Médaille
N°1 pour apprendre & réviser du collège au lycée.
< LISTE DES EXERCICES

La mucoviscidose

1
2
3
4
Énoncé

La mucoviscidose est la maladie génétique la plus fréquente en Europe (1/4500). Une dérégulation du transport de chlore dans les cellules entraîne une augmentation de la viscosité du mucus qui provoque des encombrements bronchiques, des infections respiratoires, des problèmes digestifs et une stérilité masculine.

De nombreuses mutations sont à l’origine de la mucoviscidose, mais la plus fréquente est due à une mutation du gène CTFR localisé sur le chromosome 7 : c’est la mutation $\Delta F508$. Le CTFR est le gène codant pour une protéine qui forme un canal permettant le passage de chlore.

Actuellement, il n’y a aucun traitement curatif de la maladie, mais la prise en charge des malades a nettement évoluée. En effet, l’espérance de vie qui ne dépassait pas la puberté il y a encore 50 ans, était en 2005 estimée à 47 ans.

Analyse du gène CFTR, chez un enfant atteint de la mucoviscidose et chez ses parents
(les allèles ont été identifiés à partir de l’analyse des cellules du sang).

CFTR normal GGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATA
CFTR muté GGCACCATTAAAGAAAATATCAT TGGTGTTTCCTATGATGAATATA
Enfant allèle 1 GGCACCATTAAAGAAAATATCAT TGGTGTTTCCTATGATGAATATA
Enfant allèle 2 GGCACCATTAAAGAAAATATCAT TGGTGTTTCCTATGATGAATATA
Mère allèle 1 GGCACCATTAAAGAAAATATCAT TGGTGTTTCCTATGATGAATATA
Mère allèle 2 GGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATA
Père allèle 1 GGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATA
Père allèle 2 GGCACCATTAAAGAAAATATCAT TGGTGTTTCCTATGATGAATATA

À partir des documents, donnez l’évènement qui est à l’origine de la maladie.